View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14796_low_9 (Length: 254)
Name: NF14796_low_9
Description: NF14796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14796_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 240
Target Start/End: Original strand, 10340024 - 10340252
Alignment:
| Q |
12 |
aaacagttttggactatcagtgcataattaaattctgtaaatactagttacaaattctatttagaactactttgcataaaattcattgtaatnnnnnnnn |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10340024 |
aaacagttttggactatcagtgcataattaaattctgtaaatactagttacaaattctatttagaactactttgcataaaattcattgtaataaaaaaaa |
10340123 |
T |
|
| Q |
112 |
nttcaactgcctgaaaataaggtatatgctgcatgataagcagcacgaaaaatgcacaagaagtccaagattgcaacttgagtaccctttatcccacaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10340124 |
attcaactgcctgaaaataaggtatatgctgcatgataagaagcacgaaaattgcacaagaagtccaagattgcaacttgagtaccctttatcccacaaa |
10340223 |
T |
|
| Q |
212 |
caaaactatggtttattttgaggcctttg |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
10340224 |
caaaactgtggtttattttgaggcctttg |
10340252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University