View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14797_low_6 (Length: 261)
Name: NF14797_low_6
Description: NF14797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14797_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 31769843 - 31769594
Alignment:
| Q |
1 |
tcttgttgttgctatacttgctgcataaggaggaagcttaggaagatgatgaacattccggtaatgttgccttccttctgtataatgtttgttaaaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769843 |
tcttgttgttgctatacttgctgcataaggaggaagcttaggaagatgatgaacattccggtaatgttgccttccttctgtataatgtttgttaaaattt |
31769744 |
T |
|
| Q |
101 |
aattcgcttgttttagctttataatattccggtaatgttctttatattatgatatattatatagagggagactttctttagcaacttcttgtatctttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769743 |
aattcgcttgttttagctttataatattccggtaatgttctttatattatgatatagtatatggagggagactttctttagcaacttcttgtatctttaa |
31769644 |
T |
|
| Q |
201 |
atgtttcattactaattttcattctatgtcagggaggctatgttgatgat |
250 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769643 |
atgtttcattactcattttcattctatgtcagggaggctatgttgatgat |
31769594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 8966892 - 8966966
Alignment:
| Q |
4 |
tgttgttgctatacttgctgcataaggaggaagcttaggaagatgatgaacattccggtaatgttgccttccttc |
78 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||| |||||||| | ||||| | |||||| | ||||||||| |
|
|
| T |
8966892 |
tgttgttgctatacttgttgcattaggagaaagcttcggaagatgttaaacatcacagtaatgattccttccttc |
8966966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University