View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14797_low_7 (Length: 211)
Name: NF14797_low_7
Description: NF14797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14797_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 90 - 195
Target Start/End: Complemental strand, 5336708 - 5336601
Alignment:
| Q |
90 |
gctgctaaggtaactcttgtctgtatctctacctctctctc--cctttacacgcagcctcatgatcgttgaatcttctattatgagcttggttgtaacaa |
187 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
5336708 |
gctgctaaggtaactcttttctgtatctctccctctctctctccctttacgcgcagcctcatgatcgttgaatcttcttttctgagcttggttgtaacaa |
5336609 |
T |
|
| Q |
188 |
tgaatatc |
195 |
Q |
| |
|
|||||||| |
|
|
| T |
5336608 |
tgaatatc |
5336601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 5336634 - 5336703
Alignment:
| Q |
19 |
agattcaacgatcatgaggccgcttgtaaagggaga--gagagggagagatacagaaaagagttacctta |
86 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5336634 |
agattcaacgatcatgaggctgcgcgtaaagggagagagagagggagagatacagaaaagagttacctta |
5336703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 195
Target Start/End: Original strand, 52719042 - 52719148
Alignment:
| Q |
92 |
tgctaaggtaactcttgtctgtatctctacctctctctcccttta--cacgcagcctcatgatcgttgaatcttctattatgagc-ttggttgtaacaat |
188 |
Q |
| |
|
||||||||||||| || ||||| ||||| |||||| ||||||||| | | ||| || |||||| || |||||||||| ||||| |||||||||||||| |
|
|
| T |
52719042 |
tgctaaggtaactattttctgtctctctccctctccctccctttaggcgcacagacttatgatccttagatcttctattctgagctttggttgtaacaat |
52719141 |
T |
|
| Q |
189 |
gaatatc |
195 |
Q |
| |
|
| ||||| |
|
|
| T |
52719142 |
ggatatc |
52719148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 86
Target Start/End: Complemental strand, 52719086 - 52719045
Alignment:
| Q |
45 |
taaagggagagagagggagagatacagaaaagagttacctta |
86 |
Q |
| |
|
||||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
52719086 |
taaagggagggagagggagagagacagaaaatagttacctta |
52719045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University