View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14798_high_15 (Length: 354)
Name: NF14798_high_15
Description: NF14798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14798_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 9 - 338
Target Start/End: Original strand, 37196742 - 37197071
Alignment:
| Q |
9 |
aggccagtcatgagggaaacatataacatgtttaaggatggcggggatcctgaaaaggtgtgctcaataatgcctttgtaaatttcataaaataaaaaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196742 |
aggccagtcatgagggaaacatataacatgtttaaggatggcggggatcctgaaaaggtgtgctcaataatgcctttgtaaatttcataaaataaaaaat |
37196841 |
T |
|
| Q |
109 |
ccctttcacaatttaaatgcagttatttatgttagatttatttccttacggctttatgaaatgcaatctgatactagcaattgatttacccgtgcagctt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196842 |
ccctttcacaatttaaatgcagttatttatgttagatttatttccttacggctttatgaaatgcaatctgatactagcaattgatttacccgtgcagctt |
37196941 |
T |
|
| Q |
209 |
gtaggtgcattctccaatagcagagaaagcgattatttttatgcttcactgtatgctgggctttattacgaatctcaggtattctaactataccagttac |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196942 |
gtaggtgcattctccaatagcagagaaagcgattatttttatgcttcactgtatgctgggctttattacgaatctcaggtattctaactataccagttac |
37197041 |
T |
|
| Q |
309 |
tccaatcttgaacgtcttaagagattatat |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37197042 |
tccaatcttgaacgtcttaagagattatat |
37197071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University