View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14798_high_18 (Length: 332)
Name: NF14798_high_18
Description: NF14798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14798_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 184 - 325
Target Start/End: Original strand, 7625210 - 7625351
Alignment:
| Q |
184 |
tttctagattgtgatttctttggcaatatatggaatgatgttttttgctagctgggtattggttttatgaatttagcagacataggagagcatgctttgc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7625210 |
tttctagattgtgatttctttggcaatatatggaatgatgttttttgctagctgggtattggttttatgaatttagcagacataggagagcatgctttgc |
7625309 |
T |
 |
| Q |
284 |
aatttggtggtgctaacttgttcaaaaacgaagtaagttcat |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7625310 |
aatttggtggtgctaacttgttcaaaaacgaagtaagttcat |
7625351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 23 - 148
Target Start/End: Original strand, 7625078 - 7625203
Alignment:
| Q |
23 |
gatcctcgtaggttgtttttctagcagactttgctcgataacgttcgtaannnnnnnnnatcaattgaataaggattgtctcttgagtcatggagtggta |
122 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7625078 |
gatcctcgtaggttgtctttccagcagactttgcttgataacgtttgtaaattttttttatcaattgaattaggattgtctcttgagtcatggagtggta |
7625177 |
T |
 |
| Q |
123 |
agttctacttctttgcattgtctggg |
148 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7625178 |
agttctacttctttgcattgtctggg |
7625203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University