View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14798_low_26 (Length: 321)
Name: NF14798_low_26
Description: NF14798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14798_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 211 - 306
Target Start/End: Original strand, 8346349 - 8346444
Alignment:
| Q |
211 |
cctgatgcccaagatagagatacttgaggcccaaattagacatcatgaaacatcaaggcnnnnnnnttcttgtaagtacattgctggctgtctgtg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || || |||||||||||||||||||||||| |
|
|
| T |
8346349 |
cctgatgcccaagatagagatacttgaggcccaaattagacatcatgaaacaccaaggcaattttttttttttaagtacattgctggctgtctgtg |
8346444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 60 - 122
Target Start/End: Original strand, 8346202 - 8346264
Alignment:
| Q |
60 |
attatctgatgatttcagatatagtcttaacattcgtcagcatcccgtttcaactacaggggc |
122 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
8346202 |
attatctgatgatttcagatatagtctcaacattcgtcaacatcccgtttcgactacaggggc |
8346264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 60 - 115
Target Start/End: Complemental strand, 12755467 - 12755412
Alignment:
| Q |
60 |
attatctgatgatttcagatatagtcttaacattcgtcagcatcccgtttcaacta |
115 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||||||||||| | ||||||||| |||| |
|
|
| T |
12755467 |
attatttgatgatttcagagatagttttaacattcgtcaacctcccgtttcgacta |
12755412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 60 - 123
Target Start/End: Complemental strand, 52053959 - 52053896
Alignment:
| Q |
60 |
attatctgatgatttcagatatagtcttaacattcgtcagcatcccgtttcaactacaggggcg |
123 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||| ||||| | ||||||||| ||||| |||||| |
|
|
| T |
52053959 |
attatttgatgatttcagagatagtctcaacatccgtcaacctcccgtttcgactacgggggcg |
52053896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 60 - 121
Target Start/End: Original strand, 32447839 - 32447900
Alignment:
| Q |
60 |
attatctgatgatttcagatatagtcttaacattcgtcagcatcccgtttcaactacagggg |
121 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||| ||||| | ||||||||| ||||| |||| |
|
|
| T |
32447839 |
attatttgatgatttcagagatagtctcaacatccgtcaacctcccgtttcgactacggggg |
32447900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University