View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14798_low_27 (Length: 279)
Name: NF14798_low_27
Description: NF14798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14798_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 20995524 - 20995290
Alignment:
| Q |
1 |
agtcatggccagcagcctggagtgtagtgtagcagtaacatgataaa-cgaacaaaactaaatgcagaatcccggtagaagtgaggaaacagggtaatgc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||| | |
|
|
| T |
20995524 |
agtcatggccagcagcctggagtgtagtgtagcagtaacatgataaaacgaacaaaactaaatgcagaatcccgataaaagtgaggaaacagggtaactc |
20995425 |
T |
|
| Q |
100 |
cgcacggtacactaagtcatggatttgtaaatttagtaaatatgcgttgaaaccttatcggcgtgcgagaaaagaaaagatagtgtgtatcaaaacactc |
199 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20995424 |
cgcacggtacgctaagtcgaggatttgtaaattgagtaaatatgcgttgaaaccttatcggcgtgcgagaaaagaaaagatagtgtgtatcaaaacactc |
20995325 |
T |
|
| Q |
200 |
tataattcctacacaagcaagaccgggcacgttgtgt |
236 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||| |
|
|
| T |
20995324 |
--taatacctacacaagcagtaccgggcacattgtgt |
20995290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 131 - 218
Target Start/End: Complemental strand, 21005599 - 21005512
Alignment:
| Q |
131 |
tttagtaaatatgcgttgaaaccttatcggcgtgcgagaaaagaaaagatagtgtgtatcaaaacactctataattcctacacaagca |
218 |
Q |
| |
|
||||||||| | ||||||||| ||||||| |||||||||| |||||||| |||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
21005599 |
tttagtaaacctacgttgaaacattatcgggttgcgagaaaataaaagataatgtgcatccaaacactctataatacctacacaagca |
21005512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 231 - 279
Target Start/End: Original strand, 20995311 - 20995357
Alignment:
| Q |
231 |
ttgtgtaggtattatagagtgttttgatactcactatcttttcttttct |
279 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
20995311 |
ttgtgtaggtatta--gagtgttttgatacacactatcttttcttttct |
20995357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 231 - 279
Target Start/End: Original strand, 21005515 - 21005563
Alignment:
| Q |
231 |
ttgtgtaggtattatagagtgttttgatactcactatcttttcttttct |
279 |
Q |
| |
|
|||||||||||||||||||||||| ||| | || |||||||| |||||| |
|
|
| T |
21005515 |
ttgtgtaggtattatagagtgtttggatgcacattatcttttattttct |
21005563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University