View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14798_low_33 (Length: 225)
Name: NF14798_low_33
Description: NF14798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14798_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 34247666 - 34247463
Alignment:
| Q |
19 |
gagacatctgcagatatgagtccaaatatgagtaatggaaaagcttatggtgcatttagcaatgctgttcagattgtgttgaaggaaaataaggcgaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34247666 |
gagacatctgcagatatgagtccaaatatgagtaatggaaaagcttatggtgcatttagcaatgctgttcagattgtgttgaaggaaaataaggggaaat |
34247567 |
T |
 |
| Q |
119 |
taagtaatagagaggttgtggtaaaggctagggatgttctaaaaggacaaggatttgtgcaacatccttgtctttattgtagtgatgagaatgctgatga |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34247566 |
taagtaatagagaggttgtggtgaaggctagggatgttctaaaaggacaaggatttgtgcaacatccttgtctttattgtagtgatgagaatgctgatga |
34247467 |
T |
 |
| Q |
219 |
tgtc |
222 |
Q |
| |
|
|||| |
|
|
| T |
34247466 |
tgtc |
34247463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University