View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_high_12 (Length: 292)
Name: NF1479_high_12
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 27771521 - 27771243
Alignment:
| Q |
1 |
tcaagaaatgaaactgtttcagaaga---aaaaatagttatggaagaagcaatgattcatcatagtagagttgattcaaaggcgccttcattgcgcgctt |
97 |
Q |
| |
|
||||||||||||||| ||| |||||| | |||||||| |||||||||||||||| || |||||||||||||| || |||||||| ||||||||||||| |
|
|
| T |
27771521 |
tcaagaaatgaaacttttttagaagagcaacaaatagttgtggaagaagcaatgatgcaacatagtagagttgagtcgaaggcgccatcattgcgcgctt |
27771422 |
T |
|
| Q |
98 |
ttagtgatttgtgtaatttgcaaggaagagaaagaataatcgaaattagagacgaagtttgtgaatcgatcggaaggtcagtgtctatggatcattcatt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27771421 |
ttagtgatttgtgtaatttgcaaggaagagaaagaataatcgaaattagagacgaagtttgtgaatcgatcggaaggtcagtgtctatggatcattcatt |
27771322 |
T |
|
| Q |
198 |
tcaaaatggtttttcaattggtgatgtgttgaatatgaatgaagatgaagatgattcttgtgaagaaggatgttcaatg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27771321 |
tcaaaatggtttttcaattggtgatgtgttgaatatgaatgaagatgaagatgattcttgtgaagaaggatgttcaatg |
27771243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University