View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_high_16 (Length: 264)
Name: NF1479_high_16
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 28436568 - 28436815
Alignment:
| Q |
1 |
actagaacaaaggaagaaactgaaagaggaaggagttattggaagtacaatggacgcactagacggagcagcatcagtagttggttctggtgctggactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28436568 |
actagaacaaaggaagaaactgaaagaggaaggagttattggaagtacaatggacgcactagacggagcagcatcagtagttggttctggtgctggactt |
28436667 |
T |
|
| Q |
101 |
gtaggaagtgggattggtgctggagctggaatggtgggacacggatttggtgctggagctggaattgttggcagtgggcttggtgccgtaggcagtggac |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28436668 |
gtaggaagtgggattggtgctggagatggaatggtgggacacggatttggtgctggagctggaattgttggcagtgggcttggtgccgtaggcagtggac |
28436767 |
T |
|
| Q |
201 |
tgagcagggcaggaaagttcatgggcaggacaatcacagggcaatctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28436768 |
tgagcagggcaggaaagttcatgggcaggacaatcacagggcaatctg |
28436815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 94 - 240
Target Start/End: Complemental strand, 12966902 - 12966756
Alignment:
| Q |
94 |
tggacttgtaggaagtgggattggtgctggagctggaatggtgggacacggatttggtgctggagctggaattgttggcagtgggcttggtgccgtaggc |
193 |
Q |
| |
|
|||||| || |||| ||| ||||| || ||||||||| | || ||| ||| ||||||||||||||||| ||||||||||||| |||| ||| | || |
|
|
| T |
12966902 |
tggactagtcggaactggcattggcgccggagctggacttgtcggaagcggcattggtgctggagctggacttgttggcagtggttttggagcctttggt |
12966803 |
T |
|
| Q |
194 |
agtggactgagcagggcaggaaagttcatgggcaggacaatcacagg |
240 |
Q |
| |
|
|| ||||| |||| |||||||||||| ||||| ||||| || ||||| |
|
|
| T |
12966802 |
agcggacttagcaaggcaggaaagtttatgggaaggaccataacagg |
12966756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University