View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_high_18 (Length: 258)
Name: NF1479_high_18
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 37024777 - 37025028
Alignment:
| Q |
1 |
tggtatgtgggagccagataaggaggcatggaagagactatgcatcagcttcctcaagggtcattattgtgaaagaaatggaatagaaaatatgaacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024777 |
tggtatgtgggagccagataaggaggcatggaagagactatgcatcagcttcctcaagggtcgttattgtgaaagaaatggaatagaaaatatgaacatt |
37024876 |
T |
 |
| Q |
101 |
ggtggtatattctaaagttgtaatcgtatggaagaagaagttaataggaaactaagggtccccccgctaattaaggtgtggcacatgcaccagctat--- |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024877 |
ggtggtatattctaaagtagtaatcgtatg---gaagaagttaataggaaactaagggtccccccgctaattaaggtgtggcacatgcaccagctatcta |
37024973 |
T |
 |
| Q |
198 |
-ctaactagatgcatgtgttattaatattagtgatagaattatgtggaatctctg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024974 |
actaactagatgcatgtgttattaatattagtgatagaattatgtggaatctctg |
37025028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University