View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_high_26 (Length: 237)
Name: NF1479_high_26
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_high_26 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 41468392 - 41468166
Alignment:
| Q |
11 |
caaaggaaagcaagtaatgtcaggtgtatgggtatttgacaagaaaggtgtggtgaggttaataaccaacccaacaagagaatcctttgagcacaagaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41468392 |
caaaggaaagcaagtaatgtcaggtgtatgggtatttgacaagaaaggtgtggtgaggttaataaccaacccaacaagagaatccttcgagcacaagaca |
41468293 |
T |
|
| Q |
111 |
gaaccaggaacaggaacagcaacagcaccaggtgcaagaccaagaattcttgtatatcttccaacaaacaaagtcattcattccttctctcaacttgagc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41468292 |
gaaccaggaacaggaacagcaacagcaccaggtgcaagaccaagagttcttgtatatcttccaacaaaccaagtcattcattccttctctcaacttgagc |
41468193 |
T |
|
| Q |
211 |
aacgactcactgaacttggttggactc |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41468192 |
aacgactcactgaacttggttggactc |
41468166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University