View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_high_27 (Length: 235)
Name: NF1479_high_27
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 9037878 - 9038077
Alignment:
| Q |
1 |
tgtggccggatttattagtttatgaaaagtctcgactaataaacattgctttttgggatgatcaatggaaagcgcatggaacttgctccaatatggatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9037878 |
tgtggccggatttattagtttatgaaaagtctcgactaataaacattgctttttgggatgagcaatggaaagcgcatggaagttgctccaatatggatat |
9037977 |
T |
 |
| Q |
101 |
aattga-----------------tttccatttataagaaaatcggttctctaaaggaagtccttgggaaagagggctattcacccggtcctcaaagccat |
183 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9037978 |
aattgatttcttcaagctcagtctttccatttataagaaaatcggttctctaaaggaagtccttgggaaagagggctattcacccggtcctcaaagccat |
9038077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University