View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_high_30 (Length: 225)
Name: NF1479_high_30
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 14 - 207
Target Start/End: Original strand, 29439206 - 29439384
Alignment:
| Q |
14 |
agagaagggtgtgaaaagatgatgagggtggtgcaaaaaaccaacttcagcaataaactccattaaacatgaagacaacaatggaatttgacagtgatga |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29439206 |
agagaagggtgtgaaaaggtgatgagggtggtgcaaaaaaccaacttcagcaataaactccattaa-catgaagacaacaatggaatttgaca------- |
29439297 |
T |
|
| Q |
114 |
ggagacacgagttcatgagtttgtgttagcacaaagagtggagtgtgtgaagaaatgaagaggtttggataaaagatagggattcggattcaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
29439298 |
-------cgagttcatgagtttgtgttagcacaaagagtggagtgtgtgaagaaatgaagaggtttggataaaatatagggatccggattcaat |
29439384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University