View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1479_high_30 (Length: 225)

Name: NF1479_high_30
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1479_high_30
NF1479_high_30
[»] chr5 (1 HSPs)
chr5 (14-207)||(29439206-29439384)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 14 - 207
Target Start/End: Original strand, 29439206 - 29439384
Alignment:
14 agagaagggtgtgaaaagatgatgagggtggtgcaaaaaaccaacttcagcaataaactccattaaacatgaagacaacaatggaatttgacagtgatga 113  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||           
29439206 agagaagggtgtgaaaaggtgatgagggtggtgcaaaaaaccaacttcagcaataaactccattaa-catgaagacaacaatggaatttgaca------- 29439297  T
114 ggagacacgagttcatgagtttgtgttagcacaaagagtggagtgtgtgaagaaatgaagaggtttggataaaagatagggattcggattcaat 207  Q
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||    
29439298 -------cgagttcatgagtttgtgttagcacaaagagtggagtgtgtgaagaaatgaagaggtttggataaaatatagggatccggattcaat 29439384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University