View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_low_16 (Length: 275)
Name: NF1479_low_16
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 41346361 - 41346620
Alignment:
| Q |
1 |
catcatggtccatggagatggaggtgtaagactcaacatcctcaatagtataaagacattgtcaacgtccccttcagatgtaatgactcagtcagtaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41346361 |
catcatggtccatggagatggaggtgtaagactcaacatcctcaatagtataaagacattgtcaacgtccccttcagatgtaatgactcggtcagtaaac |
41346460 |
T |
 |
| Q |
101 |
aaaatacggaaaggtatttatgtttcaaatgacgttattcaaagtacaagtcatccaacaagacggaatcatgaccattgacgttatctacatttttgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
41346461 |
aaaatacggaaaggtatttatgtttcaaatgacgttattcaaagtacaagtcatccaacaagaaggaatgaagaccattgacgttagctacatttttgct |
41346560 |
T |
 |
| Q |
201 |
tataatttgggatgaaggaagtattagataacttcattttaaaagttagcctcaaatttt |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346561 |
tataatttgggatgaagggagtattagataacttcattttaaaagttagcctcaaatttt |
41346620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 193 - 226
Target Start/End: Complemental strand, 13351628 - 13351595
Alignment:
| Q |
193 |
tttttgcttataatttgggatgaaggaagtatta |
226 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
13351628 |
tttttgcttataatttgggatggaggaagtatta |
13351595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University