View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_low_19 (Length: 264)
Name: NF1479_low_19
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 37024448 - 37024658
Alignment:
| Q |
18 |
agagctacctgccaaggctgaagtgattgctaaatcagataagactggaattgagatgtttagatatggagatcacattatgggaattcaaggtcatcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024448 |
agagctacctgccaaggctgaagtgattgctaaatcagataagactggaattgagatgtttagatatggagatcacattatgggaattcaaggtcatcct |
37024547 |
T |
|
| Q |
118 |
gagtactctaaagacattcttttgaacattattgaccgtcttattcagcgaaatttcatcacggtataaccatcattttcacttattacttcatttattt |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37024548 |
gagtactctaaagacatccttttgaacattattgaccgtcttattcagcgaaatttcatcacggtataaccatcattttcacttattacttcatttattt |
37024647 |
T |
|
| Q |
218 |
atttgcaatac |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
37024648 |
atttgcaatac |
37024658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 15 - 141
Target Start/End: Complemental strand, 35902488 - 35902362
Alignment:
| Q |
15 |
tcaagagctacctgccaaggctgaagtgattgctaaatcagataagactggaattgagatgtttagatatggagatcacattatgggaattcaaggtcat |
114 |
Q |
| |
|
||||||| ||||||| ||||| || || ||||||| |||||||| ||||||||||||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
35902488 |
tcaagagttacctgcaaaggcagaggtaattgctaggtcagataaaactggaattgagatgtttaaatatggagatcatattatgggaatccaaggtcat |
35902389 |
T |
|
| Q |
115 |
cctgagtactctaaagacattcttttg |
141 |
Q |
| |
|
|| |||||||||||||| ||||||||| |
|
|
| T |
35902388 |
ccagagtactctaaagatattcttttg |
35902362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 95
Target Start/End: Complemental strand, 2052037 - 2051994
Alignment:
| Q |
52 |
tcagataagactggaattgagatgtttagatatggagatcacat |
95 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
2052037 |
tcagaaaagactggaattgagatgtttaggtatggaaatcacat |
2051994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University