View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_low_23 (Length: 248)
Name: NF1479_low_23
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_low_23 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 9037556 - 9037807
Alignment:
| Q |
1 |
tcccacccatttcgagcattttatgatggtc----cagagatggccgaagacattttgccaaactaagaaatgtagtaaggacattcaacctctaccaac |
96 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9037556 |
tcccacccattttgagcattttatgatggtcgatccagagatggccaaagacattttgccaaactgttaaatgtagtaaggacattcaacctctaccaac |
9037655 |
T |
 |
| Q |
97 |
agaattcgttatgcatggattgtggcctgccaacagagttatatctgatccacgtgattgtttagataaaaccaaccaaaagacaatagatattggcaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9037656 |
agaattcgttatgcatggattgtggcctgctaacagagttatatctgatccacgtggttgtttagataaaaccaaccaaaagacaatagatattggcaat |
9037755 |
T |
 |
| Q |
197 |
gtaggtgtatttattttcttcgttcactgtttatcattatttttatatgatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9037756 |
gtaggtgtatttattttcttcgttcattgtttatcattatttttatatgatt |
9037807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University