View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_low_25 (Length: 243)
Name: NF1479_low_25
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 41346367 - 41346286
Alignment:
| Q |
1 |
catgatgaaatgcaactccttacacctgtccactatacccaatccttcgtatacgttcaaaatgtagaaatataaggtgatt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346367 |
catgatgaaatgcaactccttacacctgtccactatacccaatccttcgtatacgttcaaaatgtagaaatataaggtgatt |
41346286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 165 - 224
Target Start/End: Complemental strand, 41346209 - 41346150
Alignment:
| Q |
165 |
atcagagggttgagatatctttcaaatggcagactacatgaattgaatccggttcttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346209 |
atcagagggttgagatatctttcaaatggcagactacatgaattgaatccggttcttttt |
41346150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University