View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1479_low_26 (Length: 242)

Name: NF1479_low_26
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1479_low_26
NF1479_low_26
[»] chr2 (2 HSPs)
chr2 (1-224)||(4178671-4178894)
chr2 (1-220)||(4167748-4167967)
[»] chr4 (1 HSPs)
chr4 (5-220)||(34944507-34944722)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 4178894 - 4178671
Alignment:
1 ttgctgcaaaatatcgcataaagtttatagatttcatgcatgcaatgatgtcaattctggtgtttgcagcaattgcattgtttgatcagaatgtggtgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4178894 ttgctgcaaaatatcgcataaagtttatagatttcatgcatgcgatgatgtcaattctggtgtttgcagcaattgcattgtttgatcagaatgtggtgaa 4178795  T
101 ttgcttttttccagaaccatcaaaagagatacaagaaatcctcacggcgttgcctgtggcaattggcgttttttgcagcatgcttttcgttgcatttcct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4178794 ttgcttttttccagaaccatcaaaagagatacaagaaatcctcacggcgttgcctgtggcaattggcgttttttgcagcatgcttttcgttgcatttcct 4178695  T
201 actgagagacatggaattgggttc 224  Q
    ||||||||||||||||||||||||    
4178694 actgagagacatggaattgggttc 4178671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 4167967 - 4167748
Alignment:
1 ttgctgcaaaatatcgcataaagtttatagatttcatgcatgcaatgatgtcaattctggtgtttgcagcaattgcattgtttgatcagaatgtggtgaa 100  Q
    ||||||| ||||| ||||||  |||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||    
4167967 ttgctgctaaataccgcatacggtttatagattttatgcatgcagtaatgtcaattctggtgtttgcagcaattgcattgtttgatcggaatgtggtgaa 4167868  T
101 ttgcttttttccagaaccatcaaaagagatacaagaaatcctcacggcgttgcctgtggcaattggcgttttttgcagcatgcttttcgttgcatttcct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||    
4167867 ttgcttttttccagaaccatcaaaagagatacaagaaatcctcacggcgttgcctgtggcaattggcgatttttgcagcatgcttttcgttacatttcct 4167768  T
201 actgagagacatggaattgg 220  Q
    || |||||||||||||||||    
4167767 acagagagacatggaattgg 4167748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 34944507 - 34944722
Alignment:
5 tgcaaaatatcgcataaagtttatagatttcatgcatgcaatgatgtcaattctggtgtttgcagcaattgcattgtttgatcagaatgtggtgaattgc 104  Q
    |||||||||||   ||| ||| || ||||||||||||||||| ||||||||| |||| ||| |||| |||||| |||||||||| |||||||| || ||     
34944507 tgcaaaatatcaactaaggttcattgatttcatgcatgcaattatgtcaattttggttttttcagctattgcaatgtttgatcataatgtggttaactgt 34944606  T
105 ttttttccagaaccatcaaaagagatacaagaaatcctcacggcgttgcctgtggcaattggcgttttttgcagcatgcttttcgttgcatttcctactg 204  Q
    || ||||||  ||| ||| | ||||| |   ||||||| || || |||||||| | |||||| ||||| || |||||||| || |||||||||||||||     
34944607 ttctttccatcaccttcatatgagatgcgtcaaatccttactgcattgcctgttggaattggtgttttctgtagcatgctgtttgttgcatttcctactc 34944706  T
205 agagacatggaattgg 220  Q
    | ||||||||||||||    
34944707 atagacatggaattgg 34944722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University