View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_low_33 (Length: 223)
Name: NF1479_low_33
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 41467704 - 41467854
Alignment:
| Q |
13 |
acaacataactatgacgataaaatattttaacctaaactgaaaaaatactaattaaaaagctaattaccactaccaacaaagaaattactcaatgattgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41467704 |
acaacataactatgacgataaaatatttaaacctaaactgaaaaaatattaattaaaaagctaattaccactaccaacaaagaaattactcaatgatcgt |
41467803 |
T |
 |
| Q |
113 |
gatatcattaacagagggatcgataattcatgtactacttgttcatcaaaa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41467804 |
gatatcattaacagagggatcgataattcatgtactacttgttcatcaaaa |
41467854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 223
Target Start/End: Original strand, 41467886 - 41467920
Alignment:
| Q |
189 |
gctagggcaggaacatagggcaagaggaatttttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41467886 |
gctagggcaggaacatagggcaagaggaatttttt |
41467920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University