View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1479_low_5 (Length: 362)
Name: NF1479_low_5
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1479_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 17 - 352
Target Start/End: Complemental strand, 34567375 - 34567037
Alignment:
| Q |
17 |
agcattgttcaccatacacatggtatgattac---acccaaaattatgggtcatagtcactttcattaagttgaaccatactctgaaattaatttatata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567375 |
agcattgttcaccatacacatggtatgattactacacccaaaattatgggtcatagtcactttcattaagttgaaccatactctgaaattaatttatata |
34567276 |
T |
 |
| Q |
114 |
ggataatgatatggctactagtccatgcttcaaatatgtggtcttgcctgatcctctgctatgctatcaaagattattccgattcttggttggagccatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567275 |
ggataatgatatggctactagtccatgcttcaaatatgtggtcttgcctgatcctctgctatgctatcaaagattattccgattcttggttggagccatt |
34567176 |
T |
 |
| Q |
214 |
ggttttgattaagtgacgcgtcttaattgcaagcctaaaccaaaatcttagttcttctaataggacaacgttataataaatattataatatgtttttatg |
313 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567175 |
ggttctgattaagtgacgcgtcttaattgcaagcctaaaccaaaatcttagttcttctaataggacaacgttataataaatattataatatgtttttatg |
34567076 |
T |
 |
| Q |
314 |
gaagnnnnnnntgctataaaaatgttttaatcttctgtg |
352 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
34567075 |
gaagaaaaaaatgctataaaaatgttttaatcttctgtg |
34567037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University