View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14800_high_16 (Length: 226)
Name: NF14800_high_16
Description: NF14800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14800_high_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 48586025 - 48585805
Alignment:
| Q |
6 |
agttaggcagattctatggatcgatcaagttcgttatgagctcagagagttgtatggaattggtaactcaacagcacctgatttcgatcgtaatgatcct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48586025 |
agttaggcagattctatggatcgatcaagttcgttatgagctcagagagttgtatggaattggtaactcaacagcacctgatttcgatcgtaatgatcct |
48585926 |
T |
|
| Q |
106 |
ggaaaggagtgtgtaatatgcatgacagaaccaaaggatactgctgtcttaccttgccgacacatggtatcattactagttgtttgtttgggtttcacat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48585925 |
ggaaaggagtgtgtaatatgcatgacagaaccaaaggatactgctgtcttaccttgccgacacatggtatcattactagttgtttgtttgggtttcacat |
48585826 |
T |
|
| Q |
206 |
aatgtgtattatgttgcatta |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48585825 |
aatgtgtattatgttgcatta |
48585805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 7636675 - 7636750
Alignment:
| Q |
99 |
tgatcctggaaaggagtgtgtaatatgcatgacagaaccaaaggatactgctgtcttaccttgccgacacatggta |
174 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
7636675 |
tgatcctgggaaggagtgtgtaatatgcatgacggaaccaaaggatacagctgtcttaccttgtcgacatatggta |
7636750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University