View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14800_high_17 (Length: 223)
Name: NF14800_high_17
Description: NF14800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14800_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 37916166 - 37915961
Alignment:
| Q |
9 |
aggagaccacggaagtttaagtttcttttattcacaatgtgataatgatttagatttctctctcttaatcttatagttctatggtagagttgcaccatgt |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37916166 |
aggagaccatggaagtttaagtttcttttattcacaatgtgataatgatttagagttctctctcttaatcttatagttctatggtagagttgcaccatgt |
37916067 |
T |
|
| Q |
109 |
agcagctggagaggatagtatgagtttctttcattcacatgctacaaatatcaccaagttgttcattatagatactgataaaattaggcgtttgagacct |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
37916066 |
agcagctggagaggatagtatgagtttttttcattcacatgctacaaatatcaccaagttgttcattatagatactgatgaaattagtcatttgagacct |
37915967 |
T |
|
| Q |
209 |
ctcaag |
214 |
Q |
| |
|
|||||| |
|
|
| T |
37915966 |
ctcaag |
37915961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 77 - 214
Target Start/End: Complemental strand, 37907935 - 37907798
Alignment:
| Q |
77 |
tcttatagttctatggtagagttgcaccatgtagcagctggagaggatagtatgagtttctttcattcacatgctacaaatatcaccaagttgttcatta |
176 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||| ||||||| ||||||||||||||| |||||||||||||||||| |||||| ||| |
|
|
| T |
37907935 |
tcttattgttctatggtagagttgcaccatgtatctgctggagacgatagtagaagtttctttcattcagttgctacaaatatcaccaaattgttcttta |
37907836 |
T |
|
| Q |
177 |
tagatactgataaaattaggcgtttgagacctctcaag |
214 |
Q |
| |
|
|||||| |||| ||| || | |||||||||||||||| |
|
|
| T |
37907835 |
tagatattgatgaaagcagtcatttgagacctctcaag |
37907798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University