View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14801_high_3 (Length: 393)
Name: NF14801_high_3
Description: NF14801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14801_high_3 |
 |  |
|
| [»] scaffold0722 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0722 (Bit Score: 165; Significance: 4e-88; HSPs: 1)
Name: scaffold0722
Description:
Target: scaffold0722; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 211 - 379
Target Start/End: Complemental strand, 7407 - 7239
Alignment:
| Q |
211 |
gcatgcattattgggtcaaggtcttagtaatttgcttctccaagcaattagatgatagaaagaaaatgtcccacttaatagaggttgattattccacaaa |
310 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7407 |
gcatgcattattgggtcaaggtcttggtaatttgcttctccaagcaattagatgatagaaagaaaatgtcccacttaatagaggttgattattccacaaa |
7308 |
T |
 |
| Q |
311 |
tttgcctattcaattttgtaatgtttacttagctatatgtagcaatcaatcggtttctatttgtttttg |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7307 |
tttgcctattcaattttgtaatgtttacttagctatatgtagcaatcaatcggtttctatttgtttttg |
7239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University