View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14801_high_7 (Length: 262)
Name: NF14801_high_7
Description: NF14801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14801_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 138 - 245
Target Start/End: Original strand, 12874479 - 12874586
Alignment:
| Q |
138 |
atgtgataattgaattatgaaatcgagaaattaataaaggaataagcatgaagcatgataatgggaactaataattacgtatgtagatgttttctagtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12874479 |
atgtgataattgaattatgaaatcgagaaactaataaagaaataagcataaagcatgataatgagaactaataattacgtatgtagatgttttctagtcc |
12874578 |
T |
 |
| Q |
238 |
aggttcat |
245 |
Q |
| |
|
|||||||| |
|
|
| T |
12874579 |
aggttcat |
12874586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University