View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14801_low_9 (Length: 248)
Name: NF14801_low_9
Description: NF14801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14801_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 40258643 - 40258882
Alignment:
| Q |
10 |
atgaaacccagatgtaaaagtaaacaaaaatcattatttt-gaattcccgtaactgaatcatgttattcaacacctatgaagcattgtcacaaacacaac |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40258643 |
atgaaacccagctgtaaaagtaaacaaaaatcattatttttgaattccagtaactgaatcatgttattcaacacctatgaagcattgtcacaaacacaac |
40258742 |
T |
 |
| Q |
109 |
actgacacgtaaccagtaataatttgaaaaatatggcataattgaatgtaatgatgtgtgtccgacactgacacctatcgaacatcgagcacgtcggtgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40258743 |
actgacacgtaaccagtaataatttgaaaaatatggcataactgaatgtaatgatgtgtgtccgacactgacacctatcgaacatcgagcacgtcggtgc |
40258842 |
T |
 |
| Q |
209 |
tacaaagttcaacacaacaatactacaattttatgaagca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40258843 |
tacaaagttcaacacaacaatactacaattttatgaagca |
40258882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University