View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14802_low_16 (Length: 269)
Name: NF14802_low_16
Description: NF14802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14802_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 34435226 - 34435487
Alignment:
| Q |
1 |
ctataaccgggtggataattcattgcatttttgtgtgttattttctcatggttccgcttcttgtgtaggtacgaaaaatggatgcaatgtttaatgctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34435226 |
ctataaccgggtggataattcattgcatttttgtgtgttattttctcatggttccgcttcttgtgtaggtacgaaaaatggatgcaatgtttaatgctgc |
34435325 |
T |
|
| Q |
101 |
atattttgcagtaaatctatgtgataagatgagtggttgcagtagttctgatcacacttcatgcttgcaaaggataatattggattactttgctggagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34435326 |
atattttgcagtaaatctatgtgataagatgagtggttgcagtagttctgatcacacttcatgcttgcaaaggataatattggattactttgctggagtt |
34435425 |
T |
|
| Q |
201 |
gataatgctgatttctgcaagaaaattgatcaaagcaggtccttactagtttctgtcaccta |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34435426 |
gataatgctgatttctgcaagaaaattgatcaaagcaggtccttactagtttctgtcaccta |
34435487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University