View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14802_low_17 (Length: 257)
Name: NF14802_low_17
Description: NF14802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14802_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 37191306 - 37191539
Alignment:
| Q |
18 |
tgtgtttgtgtacgatttaacaaggaattaatgttggataggttgaagcatatagatcaaatgactcagctagtcatggtcggtttggtattactccaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191306 |
tgtgtttgtgtacgatttaacaaggaattaatgttggataggttgaagcatatagatcaaatgactcagctagtcatggtcggtttggtattactccaag |
37191405 |
T |
|
| Q |
118 |
aactgctcccgttgtaagatgcttannnnnnngtcaccttttttatcatttacataagcttgttcatgttgggtatttgaattctctaccttatattgaa |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191406 |
aactgctcccgttgtaagatgcttatttttttgtcaccttttttatcatttacataagcttgttcatgttgggtatttgaattctctaccttatattgaa |
37191505 |
T |
|
| Q |
218 |
gatgctaagttaagttatgtagagtgatgatgtc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
37191506 |
gatgctaagttaagttatgtagagtgatgttgtc |
37191539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University