View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14802_low_22 (Length: 234)
Name: NF14802_low_22
Description: NF14802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14802_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 51120727 - 51120529
Alignment:
| Q |
15 |
aatataatttacgttgaaaaaagtgagtgaagtcaaagttgtaacattttgagagaaagcgcgcaatccattggcaagattggtgggtgtgttggagaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51120727 |
aatataatttacgttgaaaaaagtgagtgaagtcaaagttgtaacattttgagagaaagctcgcaatccattggcaagattggtgggtgtgttggagaga |
51120628 |
T |
 |
| Q |
115 |
tggagtgatcgaagtttcaatgggaaaagagatatttggatgagaagtaagttgatatcattaccgtagtaagtatatcgaaaggttgagggagttaagg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
51120627 |
tggagtgatcgaagtttcaatgggaaaagagatatttggatgaaaagtaagttgatatcattaccat----agtatatcgaaaggttgagggaattaagg |
51120532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 37 - 123
Target Start/End: Complemental strand, 8186408 - 8186322
Alignment:
| Q |
37 |
gtgagtgaagtcaaagttgtaacattttgagagaaagcgcgcaatccattggcaagattggtgggtgtgttggagagatggagtgat |
123 |
Q |
| |
|
|||||||| ||||||||||||| |||| | |||| | | ||||||||||| ||| || |||||||| |||| ||||||| ||||||| |
|
|
| T |
8186408 |
gtgagtgaggtcaaagttgtaatatttcgggagagaactcgcaatccatttgcaggaatggtgggtttgttagagagattgagtgat |
8186322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University