View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14802_low_23 (Length: 220)
Name: NF14802_low_23
Description: NF14802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14802_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 49 - 213
Target Start/End: Complemental strand, 23128703 - 23128539
Alignment:
| Q |
49 |
tcggagatatcagaaaaaatcgcgtggctgatacttgttcttctctgcaaactcgatacaaaagctgaattctacaaagacgtagcactttcttatcttt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23128703 |
tcggagatatcagaaaaaatcgcgtggctgatacttgttcttctctgcaaactcgatacaaaagctgaattctacaaagacgtagcactttcttatcttt |
23128604 |
T |
 |
| Q |
149 |
ttctcgcaaataacatgcaatacgtcgtcgtaaaggttcgaagatcgaatctagggtttcttctc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23128603 |
ttctcgcaaataacatgcaatacgtcgtcgtaaaggttcgaagatcgaatctagggtttcttctc |
23128539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 89 - 213
Target Start/End: Complemental strand, 41102867 - 41102743
Alignment:
| Q |
89 |
ttctctgcaaactcgatacaaaagctgaattctacaaagacgtagcactttcttatctttttctcgcaaataacatgcaatacgtcgtcgtaaaggttcg |
188 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41102867 |
ttctctgcaaactcgacggtaaagctgagttttacaaagacgttgcactttcgtatctttttctcgcgaataacatgcaatacgtcgtcgtaaaggttcg |
41102768 |
T |
 |
| Q |
189 |
aagatcgaatctagggtttcttctc |
213 |
Q |
| |
|
| |||||||||| ||||| ||||| |
|
|
| T |
41102767 |
taaatcgaatctaaggtttattctc |
41102743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University