View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14802_low_9 (Length: 316)
Name: NF14802_low_9
Description: NF14802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14802_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 23882862 - 23883161
Alignment:
| Q |
1 |
actaatagcagtttgcaggacatgcatctcagaactgcgtactgtcatcactgaatagatactatcgaaaggatattgcatgttcttcgcgattgtccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23882862 |
actaatagcagtttgcaggacatgcatctcagaactgcgtactgtcatcacttaatagatactatcgaaaggatattgcatgttcttcgcgattatccca |
23882961 |
T |
|
| Q |
101 |
tagcaatggttgtttgcttaggactgttaattttagatatcacaaggaacttttcaacgcagatttgcagcaatggttggatatgagtatggatatggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23882962 |
tagcaatggttgtttgcttaggactgttaattttagatatcacaaggaacttttcaacgcagatttgcagcaatggttggatatgagtatggatatagtg |
23883061 |
T |
|
| Q |
201 |
ttgagtgaggggaagacccgaaattggactgttttttgggcttaggcatgtcatacttcgtggaattggaggaacagaaggatgcatgatgaggattttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23883062 |
ttgagtgaggggaagacccgaaattggactggtttttgggctaaggcatgtcatacttcgtggaattggaggaacagaaggatgcatgatgaggattttg |
23883161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 3 - 300
Target Start/End: Complemental strand, 23420427 - 23420137
Alignment:
| Q |
3 |
taatagcagtttgcaggacatgcatctcagaactgcgtactgtcatcactgaatagatactatcgaaaggatattgcatgttcttcgcgattgtcccata |
102 |
Q |
| |
|
||||||||| ||||| | |||||||||||||||||| ||| ||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
23420427 |
taatagcagattgcaagtcatgcatctcagaactgcatac-------actgaatagatactatcgaaacgacattgcatgttcttcgcgattgtcccata |
23420335 |
T |
|
| Q |
103 |
gcaatggttgtttgcttaggactgttaattttagatatcacaaggaacttttcaacgcagatttgcagcaatggttggatatgagtatggatatggtgtt |
202 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||| |
|
|
| T |
23420334 |
tcaatggttgtttgcttaagaccgttaattctagatatcataaggaacttttcaacgcagatttgcagcaatggttggagatgagtatggatacggcgtt |
23420235 |
T |
|
| Q |
203 |
gagtgaggggaagacccgaaattggactgttttttgggcttaggcatgtcatacttcgtggaattggaggaacagaaggatgcatgatgaggattttg |
300 |
Q |
| |
|
||||||| || || | ||||| |||||| ||||||| | |||||||||| | |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23420234 |
gagtgagcgggaggtctgaaatcggactggcttttgggagacgacatgtcatacgttgtggaattggaggaacagaacgatgcatgatgaggattttg |
23420137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 247 - 296
Target Start/End: Complemental strand, 23422347 - 23422298
Alignment:
| Q |
247 |
catgtcatacttcgtggaattggaggaacagaaggatgcatgatgaggat |
296 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
23422347 |
catgtcatactttgtggaattgaaggaacaaaatgatgcatgatgaggat |
23422298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 110
Target Start/End: Original strand, 23876608 - 23876677
Alignment:
| Q |
41 |
actgtcatcactgaatagatactatcgaaaggatattgcatgttcttcgcgattgtcccatagcaatggt |
110 |
Q |
| |
|
||||||| ||||| ||||| |||||| ||| || ||||||||||||||||| ||||| | |||||||||| |
|
|
| T |
23876608 |
actgtcaccactgtatagaaactatcaaaacgacattgcatgttcttcgcggttgtctcttagcaatggt |
23876677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University