View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_high_11 (Length: 303)
Name: NF14803_high_11
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 36763367 - 36763545
Alignment:
| Q |
14 |
caaaggtggggcacctggattcaaagtagcagtattgggggctgctggtggaattggtcaatccctttctttgctgttgaagatgaacccattggtttca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36763367 |
caaaggtggggcacctggattcaaagtagcagtattgggggctgctggtggaattggtcaatccctttctttgctgttgaagatgaacccactggtttca |
36763466 |
T |
 |
| Q |
114 |
gttcttcatctttacgatgtcgtcaacacccctggtgtcacagctgatgttagtcacatggacactggtgctgtggtaa |
192 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36763467 |
gttcttcatctttacgatgttgtcaacacccctggtgtcacagctgatgttagtcacatggacactggtgctgtggtaa |
36763545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 231 - 286
Target Start/End: Original strand, 36763584 - 36763639
Alignment:
| Q |
231 |
aacaaaatgttgatatcatctaaaattgtataaaacaaaaaattaaatcatatttg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36763584 |
aacaaaatgttgatatcatctaaaattgtataaaacaaaaaattaaatcatatttg |
36763639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 14 - 175
Target Start/End: Complemental strand, 4991650 - 4991489
Alignment:
| Q |
14 |
caaaggtggggcacctggattcaaagtagcagtattgggggctgctggtggaattggtcaatccctttctttgctgttgaagatgaacccattggtttca |
113 |
Q |
| |
|
||||||||| |||| ||||||||||| || | ||||| ||||| || ||||| || ||| | |||||| || || ||||||| || ||||||||||| |
|
|
| T |
4991650 |
caaaggtggatcaccaggattcaaagttgcgattttgggtgctgcagggggaataggacaacctctttctatgttgatgaagatcaatccattggtttct |
4991551 |
T |
 |
| Q |
114 |
gttcttcatctttacgatgtcgtcaacacccctggtgtcacagctgatgttagtcacatgga |
175 |
Q |
| |
|
|||||||||||||| ||||| || || || |||||||| || ||||| | ||||||||||| |
|
|
| T |
4991550 |
gttcttcatctttatgatgttgttaatactcctggtgttacttctgatatcagtcacatgga |
4991489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University