View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_high_17 (Length: 256)
Name: NF14803_high_17
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 45393645 - 45393433
Alignment:
| Q |
19 |
aagatgtgtatgtttcaaattgattttacttgacgtctctaaatgttttgtggtattcatccannnnnnnaattatgtgatctggtatttgattgtagtc |
118 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45393645 |
aagatatgtatgtttcaaattgattttacttgacgtctctaaatgttttgtggtattcatccatttttttaattatgtgatctggtatttgattgtagtc |
45393546 |
T |
 |
| Q |
119 |
aacattggcggagtagaacaggttgttacaattgtaactccgtttataatccccaatatcttagatcagtttcacaattagattggaataatagaagaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45393545 |
aacattggcggagtagaacaggttgttacaattgtaactccgtttataatccccaatatcttagatcagtttcacaattagattggaataatagaagaac |
45393446 |
T |
 |
| Q |
219 |
ctctatgataaca |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45393445 |
ctctatgataaca |
45393433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University