View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_high_2 (Length: 497)
Name: NF14803_high_2
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 442; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 442; E-Value: 0
Query Start/End: Original strand, 21 - 478
Target Start/End: Complemental strand, 48322580 - 48322123
Alignment:
| Q |
21 |
agattggaaagagagaagttgcaggttttatcacagggaagccgggttgaaaactacagacagagaaagagtcatggtgcaactaatgtggcagattgtg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48322580 |
agattggaaagagagaagttgcaggttttatcacagggaagccgggttgaaaactacagacaaagaaagagtcatggtgcaactaatgtggcagattgtg |
48322481 |
T |
|
| Q |
121 |
agagtttggataaagttttggttaagcgcgtatctagactagagaaggagaaaatcaatatcggggatgaatggggcgaagttaagaaaagtttccgaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48322480 |
agagtttggataaagttttggttaagcgcgtatctagactggagaaggagaaaatcaatatcggggatgaatggggcgaagttaagaaaagtttccgaaa |
48322381 |
T |
|
| Q |
221 |
cgaccgtttgcagacaaatgaagaaggtggtggtctggaccaagttttggttaaacataaacccagacttgagagggaaaagatggctgctgctgctcaa |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48322380 |
cgaccgtttgcagacaaatgaagaaggtggtggtctggaccaagttttggttaaacataaacccagacttgagagggaaaagatggctgctgctgctcaa |
48322281 |
T |
|
| Q |
321 |
cagcaagataatccaattagtttttctgtggctcgacgcaaggcaagggagagagaattggaagaagcctggggaggactgagcttaggaaactccatga |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48322280 |
cagcaagataatccaattagtttttctgtggctcgacgcaaggctagggagagagagttggaagaagcctggggaggactgagcttaggaaactccatga |
48322181 |
T |
|
| Q |
421 |
agcctagtgtctccaagcttgaacaagacaaggttagtatagtgttggtttgacactt |
478 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48322180 |
agcctagtgtctccaagcttgaacaagacaaggttagtatagtgttggtttgacactt |
48322123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University