View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_low_13 (Length: 349)
Name: NF14803_low_13
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 47 - 332
Target Start/End: Original strand, 31174845 - 31175130
Alignment:
| Q |
47 |
tgctaattcactctgcttcatatcatcttgtagtggaatatagagagcataaggttggtttgatggctagagtggagaagttaaggggtattatgacaat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
31174845 |
tgctaattcactctgcttcatatcatcttgtagtggaatatagcgagcataaggttggtttgatggctaaagtggagaagttaaggggtaatatgacaat |
31174944 |
T |
|
| Q |
147 |
gagattgatggttcacgccccattctcagcgtaatattaacaaaatttgattatgattttatctatgttacatataattcccctacttcatctagcttaa |
246 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31174945 |
gagattgatggttcacgtcccattctcagcgtaatattaacaaaatttgattatgattttatctatgttacatataattcccctacttcatctagcttaa |
31175044 |
T |
|
| Q |
247 |
gttgcaattgtacccaacatggttcaatatacatactcttgtctgtttttaaatgagtattcatttagtttttaagtacatgttgc |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31175045 |
gttgcaattgtacccaacatggttcaatatacatactcttgtctgtttttaaatgagtattcatttagtttctaagtacatgttgc |
31175130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 31174781 - 31174819
Alignment:
| Q |
1 |
tttcccacattattatcactcataaaaaatgtgatttta |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31174781 |
tttcccacattattatcactcataaaaaatgtaatttta |
31174819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University