View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_low_16 (Length: 306)
Name: NF14803_low_16
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 6791235 - 6791019
Alignment:
| Q |
1 |
taggattggaagagattatagataattgtaaaaatttctatttgacaggaaaggaaacaattgccaattcagtaagctgggctatctttcttttagggct |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6791235 |
taggattggatgagattatagataattgtaaaaatttctatttgacaggaaaggaaacaattgccaattcagtgagctgggctatctttcttttagggct |
6791136 |
T |
|
| Q |
101 |
gaatcaagaatggcaaagcaaggcacgtgaggaggtatttcatgttttaggacatcacacatccccaactgcagaaacattaagtgacctcaaattagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6791135 |
gaatcaagaatggcaaagcaaggcacgtgaggaggtatttcatgttttaggacatcacacatccccaactgcagaaacattaagtgacctcaaattagta |
6791036 |
T |
|
| Q |
201 |
agtttgtttatgttttt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6791035 |
agtttgtttatgttttt |
6791019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 200 - 289
Target Start/End: Complemental strand, 6791007 - 6790918
Alignment:
| Q |
200 |
aagtttgtttatgtttttatagtttgcttatttggtcaaaatattctatagatcattgagttatttttgaatttttaataagcagtctct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6791007 |
aagtttgtttatgtttttatagtttgcttatttggtcaaaatattctatagatcattgagttatttttgaatttttaataagtagtctct |
6790918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University