View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14803_low_17 (Length: 303)

Name: NF14803_low_17
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14803_low_17
NF14803_low_17
[»] chr4 (2 HSPs)
chr4 (14-192)||(36763367-36763545)
chr4 (231-286)||(36763584-36763639)
[»] chr5 (1 HSPs)
chr5 (14-175)||(4991489-4991650)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 36763367 - 36763545
Alignment:
14 caaaggtggggcacctggattcaaagtagcagtattgggggctgctggtggaattggtcaatccctttctttgctgttgaagatgaacccattggtttca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
36763367 caaaggtggggcacctggattcaaagtagcagtattgggggctgctggtggaattggtcaatccctttctttgctgttgaagatgaacccactggtttca 36763466  T
114 gttcttcatctttacgatgtcgtcaacacccctggtgtcacagctgatgttagtcacatggacactggtgctgtggtaa 192  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36763467 gttcttcatctttacgatgttgtcaacacccctggtgtcacagctgatgttagtcacatggacactggtgctgtggtaa 36763545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 231 - 286
Target Start/End: Original strand, 36763584 - 36763639
Alignment:
231 aacaaaatgttgatatcatctaaaattgtataaaacaaaaaattaaatcatatttg 286  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36763584 aacaaaatgttgatatcatctaaaattgtataaaacaaaaaattaaatcatatttg 36763639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 14 - 175
Target Start/End: Complemental strand, 4991650 - 4991489
Alignment:
14 caaaggtggggcacctggattcaaagtagcagtattgggggctgctggtggaattggtcaatccctttctttgctgttgaagatgaacccattggtttca 113  Q
    |||||||||  |||| ||||||||||| ||  | ||||| ||||| || ||||| || ||| | |||||| || || ||||||| || |||||||||||     
4991650 caaaggtggatcaccaggattcaaagttgcgattttgggtgctgcagggggaataggacaacctctttctatgttgatgaagatcaatccattggtttct 4991551  T
114 gttcttcatctttacgatgtcgtcaacacccctggtgtcacagctgatgttagtcacatgga 175  Q
    |||||||||||||| ||||| || || || |||||||| ||  ||||| | |||||||||||    
4991550 gttcttcatctttatgatgttgttaatactcctggtgttacttctgatatcagtcacatgga 4991489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University