View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_low_25 (Length: 244)
Name: NF14803_low_25
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_low_25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 244
Target Start/End: Complemental strand, 2638721 - 2638488
Alignment:
| Q |
11 |
gccgataagatttaaaactgtattttaaaattgaagctaagttatagctatcctacttactactacttgaatttaaatattgagattgctcattgctgtg |
110 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
2638721 |
gccgataagatttaaaattgtattttgaaattgaagctaagttataggtagcctacttactactactagaatttaaatattgagattgctcattcctgtg |
2638622 |
T |
|
| Q |
111 |
tgctaaataatgaagggtttgacaacaaaaagagtgtaaacatcccacaaactactgattaaccgtcctttatccttggaatttatttgaccaactttga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2638621 |
tgctaaataatgaagggtttgacaacaaaaagagtgtaaacatcccacaaactactgattaaccgtcctttatccttggaatttatttgaccaactttga |
2638522 |
T |
|
| Q |
211 |
ttggaaaacataagttccactccacaaaattgtc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2638521 |
ttggaaaacataagttccactccacaaaattgtc |
2638488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University