View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_low_26 (Length: 242)
Name: NF14803_low_26
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 11 - 161
Target Start/End: Original strand, 12498912 - 12499061
Alignment:
| Q |
11 |
cacagacactcataaacaaattttgttggtttcatctttgtttcactatggtttcacaatatgactgactcttatacccctttattatctttctttcact |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
12498912 |
cacacacactcataaacaaattttgttggtttcatctttgtttcactatggtttcataatatgactgactcttatacccctttattat-tttttttcact |
12499010 |
T |
|
| Q |
111 |
tgatatttctttcatcttgcacaacctagaatctaaatatgttgtaacata |
161 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12499011 |
tgatgttgctttcatcttgcacaacctagaatctaaatatgttgtaacata |
12499061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 155 - 228
Target Start/End: Original strand, 12499100 - 12499173
Alignment:
| Q |
155 |
taacataatagctacactaggattttgtatttgagccttttatgcttttggtatattggtgattgtttcatttg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12499100 |
taacataatagctacactaggagtttgtatttgacccttttatgcttttggtatattggtgattgtttcatttg |
12499173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University