View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14803_low_31 (Length: 202)
Name: NF14803_low_31
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14803_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 34887221 - 34887050
Alignment:
| Q |
15 |
aaaatctcttgagccaaatttaactcgggcatgatttttcatttttaacgttaaaaatttaagttgttacggataaaatactaaaattcatccacaatat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34887221 |
aaaatctcttgagccaaatttaactcgggcatgatttttcatttttaacgttaaaaatttaagttgttacggataaaatactaaaattcatccacaacat |
34887122 |
T |
|
| Q |
115 |
ggattcgaacagacaaccgcaagatccgacacacgtgcaagtatctgttttgccattggactactatgatga |
186 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
34887121 |
ggattcgaacagacaaccacaagacccgacacacgtgcaagtatctgttttgccactggaccactacgatga |
34887050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University