View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14803_low_31 (Length: 202)

Name: NF14803_low_31
Description: NF14803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14803_low_31
NF14803_low_31
[»] chr7 (1 HSPs)
chr7 (15-186)||(34887050-34887221)


Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 34887221 - 34887050
Alignment:
15 aaaatctcttgagccaaatttaactcgggcatgatttttcatttttaacgttaaaaatttaagttgttacggataaaatactaaaattcatccacaatat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
34887221 aaaatctcttgagccaaatttaactcgggcatgatttttcatttttaacgttaaaaatttaagttgttacggataaaatactaaaattcatccacaacat 34887122  T
115 ggattcgaacagacaaccgcaagatccgacacacgtgcaagtatctgttttgccattggactactatgatga 186  Q
    |||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||| |||| |||||    
34887121 ggattcgaacagacaaccacaagacccgacacacgtgcaagtatctgttttgccactggaccactacgatga 34887050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University