View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14804_low_4 (Length: 255)
Name: NF14804_low_4
Description: NF14804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14804_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 170
Target Start/End: Complemental strand, 3552373 - 3552209
Alignment:
| Q |
8 |
acattattcagggtcggggtggggaacctttggggtaataaggtggatttttctctttcaaccaaattttctctgtagacaagagtcaatattccaacac |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||| | |
|
|
| T |
3552373 |
acattattcagggtctgggtggggaacctttggggtaataaggtggatttttctctttcaaccaaattttctctataggcaagagtcaatgatccaaaag |
3552274 |
T |
 |
| Q |
108 |
cggatcacttgcttaaagggtcaaagttccttactagc--tacttggatgaaaatgatatttgta |
170 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
3552273 |
tgaatcacttgcttaaagggtcaaagtcccttactagctatatttggatgaaaatgatatttgta |
3552209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University