View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14805_high_10 (Length: 330)
Name: NF14805_high_10
Description: NF14805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14805_high_10 |
 |  |
|
| [»] scaffold0019 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0019 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 54603 - 54353
Alignment:
| Q |
1 |
tggagattttactatgaagttaggacctttctaccattttggatattgtactgctcattagttgagtgtctgcatctgcatcgttcagattcaggtgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54603 |
tggagattttactatgaagttaggacctttctaccattttggatattgtactgctcattagttgagtgtctgcatctgcatcgttcagattcaggtgaac |
54504 |
T |
 |
| Q |
101 |
gaatctgtttttctttgctatttcggcaaacctgatgatatttttagtaagttctttaaaacatagatatagtgttttgttccgtgcatatagcagacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54503 |
gaatctgtttttctttgctatttcggcaaacctgatgatatttttagtaagttctttaaaacatagatatagtgttttgttccgtgcatatagcagacga |
54404 |
T |
 |
| Q |
201 |
aagtagaggaaagactatataatggagtttctcaccaagtttccgaagctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54403 |
aagtagaggaaagactatataatggagtttctcaccaaatttccgaagctt |
54353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 252 - 316
Target Start/End: Complemental strand, 54331 - 54267
Alignment:
| Q |
252 |
atgttgcgtttttatgtttaggaatgatgattccattaaatannnnnnnctcttatcatattact |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54331 |
atgttgcgtttttatgtttaggaatgatgattccattaaatatttttttctcttatcatattact |
54267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University