View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14805_low_14 (Length: 330)

Name: NF14805_low_14
Description: NF14805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14805_low_14
NF14805_low_14
[»] scaffold0019 (2 HSPs)
scaffold0019 (1-251)||(54353-54603)
scaffold0019 (252-316)||(54267-54331)


Alignment Details
Target: scaffold0019 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 54603 - 54353
Alignment:
1 tggagattttactatgaagttaggacctttctaccattttggatattgtactgctcattagttgagtgtctgcatctgcatcgttcagattcaggtgaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54603 tggagattttactatgaagttaggacctttctaccattttggatattgtactgctcattagttgagtgtctgcatctgcatcgttcagattcaggtgaac 54504  T
101 gaatctgtttttctttgctatttcggcaaacctgatgatatttttagtaagttctttaaaacatagatatagtgttttgttccgtgcatatagcagacga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54503 gaatctgtttttctttgctatttcggcaaacctgatgatatttttagtaagttctttaaaacatagatatagtgttttgttccgtgcatatagcagacga 54404  T
201 aagtagaggaaagactatataatggagtttctcaccaagtttccgaagctt 251  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||    
54403 aagtagaggaaagactatataatggagtttctcaccaaatttccgaagctt 54353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 252 - 316
Target Start/End: Complemental strand, 54331 - 54267
Alignment:
252 atgttgcgtttttatgtttaggaatgatgattccattaaatannnnnnnctcttatcatattact 316  Q
    ||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
54331 atgttgcgtttttatgtttaggaatgatgattccattaaatatttttttctcttatcatattact 54267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University