View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14805_low_21 (Length: 272)
Name: NF14805_low_21
Description: NF14805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14805_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 10 - 164
Target Start/End: Original strand, 1746430 - 1746584
Alignment:
| Q |
10 |
tagattatactctctcaagaaccactctaaaaataagtctccactgatgaccactcacaagatggcggcttaccattggcaaatgacctaattttctgat |
109 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1746430 |
tagataatactctctcaagcaccactctaaaaataagtctccactgatgaccactcacaagatggcggcttaccattggcaaatgacctaattttctgat |
1746529 |
T |
|
| Q |
110 |
ggtgggcagtcgatgtgtccattgaaataatagttaaatatttagcagccctaat |
164 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1746530 |
ggtgggcagtcgatgtatccattgaaataatagttaaatatttagcagccctaat |
1746584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 151
Target Start/End: Original strand, 1724853 - 1724929
Alignment:
| Q |
79 |
ttaccattggcaaatgacctaattttctgatggtgggca----gtcgatgtgtccattgaaataatagttaaatatt |
151 |
Q |
| |
|
|||||| |||||||| |||||| ||||||| |||||||| ||| || |||| |||||||||||||||||||||| |
|
|
| T |
1724853 |
ttaccactggcaaattacctaagtttctgacggtgggcaaatagtcaatatgtcaattgaaataatagttaaatatt |
1724929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University