View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14805_low_27 (Length: 219)
Name: NF14805_low_27
Description: NF14805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14805_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 8695640 - 8695495
Alignment:
| Q |
18 |
gttaaataatttgaagatcgtgtgtttggtagcggggttttaggtggttatgagtggtaatccagtaaggccacattaatagaggatctaggtgaggtga |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8695640 |
gttaaataatttgaagaccgtgtgtttggtagcggggttttaggtggttatgagtggtaatctagtaaggccacattaatagaggatctaggtgaggtga |
8695541 |
T |
|
| Q |
118 |
cacattctaaaaagagcatggttgtatatcacaaaagttgcatatt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8695540 |
cacattctaaaaagagcatggttgtatatcataaaagttgcatatt |
8695495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University