View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14805_low_30 (Length: 209)
Name: NF14805_low_30
Description: NF14805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14805_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 191
Target Start/End: Original strand, 41873865 - 41874040
Alignment:
| Q |
17 |
atggaatactttaaaatacgaatatccatagaaatgcctattaggattctcgtgtgtctttgtaacattaaattt-gaggatataccacatttacaatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41873865 |
atggaatactttaaaatacgaatatccatagaaatgcctattaggattctcgtgtgtctttgtaacattaaattttgaggatataccacatttacaatta |
41873964 |
T |
 |
| Q |
116 |
ggggccgcataaaatgatcttgaagagctctcactctgactcacgtcatgcttaaaatgagatggtattgcttgtt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41873965 |
ggggccgcataaaatgatcttgaagagctctcactctgactcacgtcatgcttaaaatgagatggtatttcttgtt |
41874040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University