View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14806_low_18 (Length: 261)
Name: NF14806_low_18
Description: NF14806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14806_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 100 - 246
Target Start/End: Complemental strand, 29925179 - 29925031
Alignment:
| Q |
100 |
gtcgttttcataaataaattaatatacttgcataaactattttgttacacaagcactttttt--atggataattatataacaatttattggataatatca |
197 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29925179 |
gtcgttttcttaaataaattaatatacttgcataaactattttgttacacaagcacttttttttatggataattatataacaatttattggataatatca |
29925080 |
T |
|
| Q |
198 |
tatttaacttcttatatatgcaaatcatctcaacttatcgatatatatt |
246 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
29925079 |
tatttaacttcttacatatgcaaatcatatcaacttatcgatatatatt |
29925031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University