View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14806_low_20 (Length: 234)
Name: NF14806_low_20
Description: NF14806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14806_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 21284409 - 21284641
Alignment:
| Q |
1 |
tttttaaagaaacattacttttaaactcagctgtaaccaaatcaactgtacatcaaacacttagtagtacagtgtcacttgtgatttggttttggtatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21284409 |
tttttaaagaaacattacttttaaactcagctgtaaccaaatcaactgtacatcaaacacttagtagtacagtgtcacttgtgatttggttttggtatga |
21284508 |
T |
|
| Q |
101 |
gtaggtgacaaagtactattccttgtgagtgcacattgttgtcactgtgtggttgagttcaaattcttgttttttacttttgagagctaatgatgttgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21284509 |
gtaggtgacaaagtactattccttgtgagtgcacattgttgtcactgtgtggttgagttcaaattcttgttttttacttttgagagctaatgatgttgcc |
21284608 |
T |
|
| Q |
201 |
atgtgattgtggccatgatgttgatgtccatct |
233 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| |
|
|
| T |
21284609 |
atgtgattgtggccatgatgatgatgtgcatct |
21284641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 38064249 - 38064295
Alignment:
| Q |
167 |
ttgttttttacttttgagagctaatgatgttgccatgtgattgtggc |
213 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
38064249 |
ttgttttttgcttttgagagctaataatgttgacatgtgattgtggc |
38064295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University