View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14806_low_22 (Length: 224)
Name: NF14806_low_22
Description: NF14806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14806_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 24 - 208
Target Start/End: Complemental strand, 27548344 - 27548160
Alignment:
| Q |
24 |
atatgattatatttcaacaaagtcatttctgtataaacactcaaaatatcactccacaatagaagtgtttatttagataattaaattgatgttaagcaag |
123 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||| |||| ||||||||||| |||||| ||||||||| |
|
|
| T |
27548344 |
atatgattatatttcaacaaagtcctttctctataaacactcaaaatatcactccacaatataagtatttaattagataattagattgatattaagcaag |
27548245 |
T |
 |
| Q |
124 |
caagcatcctaccattatgaataatattgtttgtcttgaagcttttggttttagatattctcactagtggtggaagctgtttaat |
208 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27548244 |
caagcctcctaccattatgaatgatattgtttgtcttgaagcctttggttttagatattctcactagtggtggaagctgtttaat |
27548160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University