View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14806_low_24 (Length: 211)
Name: NF14806_low_24
Description: NF14806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14806_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 75 - 199
Target Start/End: Complemental strand, 26953719 - 26953595
Alignment:
| Q |
75 |
ttataattgaaaggaacaatccgtaagagtttatttagacttattaagagtttataaaagtagtttgtaatatagttatatgctcttttcagtcataagt |
174 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
26953719 |
ttataagtgaaaggaacaatccgtaagagtttatttagacttattaagagtttataaaattagtttgtaatataattataagctcttttcagtcataagt |
26953620 |
T |
 |
| Q |
175 |
tttttaacacagctcatagaattat |
199 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26953619 |
tttttaacacagctcatagaattat |
26953595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 26953801 - 26953753
Alignment:
| Q |
1 |
tcccacatacatgcaatgatatcttgtatgagatccttactagttaata |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26953801 |
tcccacatacatgcaatgatatcttgtatgagatccttactagttaata |
26953753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University